HuGE Literature Finder
Records
1
-
30
A Cross-Sectional Study of Detection of Beta Globin (HBB) Haplotypes Among Beta Thalassemia Patients. Cureus 2021 Feb 13 (2): e13367. Alsamiri Ali, Alzahrani Fatma, Filimban Najlaa, Khojah Ammar, Felimban Raed, Qadah Tal |
A Novel Frameshift Mutation, Deletion of HBB:c.199_202delAAAG [Codon 66/67 (-AAAG)] in ß-Thalassemia Major Patients from the Western Region of Uttar Pradesh, India. The application of clinical genetics 2021 14 77-85. Chauhan Waseem, Afzal Mohammad, Zaka-Ur-Rab Zeeba, Noorani Md Sal |
Hemoglobin variants in southern China: results obtained during the measurement of glycated hemoglobin in a large population. Clinical chemistry and laboratory medicine 2020 Jul . Xu Anping, Chen Weidong, Xie Weijie, Wang Yajun, Ji Li |
ß-Globin Gene Mutations in Pediatric Patients with ß-Thalassemia in the Region of Çukurova, Turkey. Hemoglobin 2020 Jul 1-5. Guzelgul Figen, Seydel G Seyda, Aksoy Kiym |
Prevalence and Diversity of Haplotypes of Sickle Cell Disease in the Eastern Province of Saudi Arabia. Hemoglobin 2020 May 1-4. Al-Ali Amein K, Alsulaiman Ahmed, Alzahrani Alhusain J, Obeid Obeid T, Vatte Chitti Babu, Cyrus Cyril, Alnafie Awatif N, Alali Rudaynah A, Alfarhan Mohammed, Mozeleski Brian, Steinberg Martin |
Karyomapping in preimplantation genetic testing for ß-thalassemia combined with HLA matching: a systematic summary. Journal of assisted reproduction and genetics 2019 Nov . Wang Jing, Lu Bao-Min, Li Rong, Guo Jing, Xu Yan, Pan Jia-Fu, Zeng Yan-Hong, Zhou Can-Quan, Xu Yan-W |
The Spectrum of ß-Thalassemia Mutations in Siirt Province, Southeastern Turkey. Hemoglobin 2019 Aug 1-8. Yilmaz Sed |
The Spectrum of ß-Thalassemia Mutations in Hamadan Province, West Iran. Hemoglobin 2019 May 1-5. Alibakhshi Reza, Moradi Keivan, Aznab Mozaffar, Azimi Azam, Shafieenia Samaneh, Biglari Mosta |
Haplotype Analysis of Three Common ß-Thalassemia Mutations in Syrian Patients. Hemoglobin 2019 Jan 1-4. Murad Hossam, Moassas Faten, Ghoury Ifad, Mukhalalaty Yass |
Use of an automated pyrosequencing technique for confirmation of sickle cell disease. PloS one 2019 14 (12): e0216020. de Martino Camila Cruz, Alencar Cecilia Salete, Loureiro Paula, Carneiro-Proietti Anna Barbara de Freitas, Máximo Claudia de Alvarenga, Mota Rosimere Afonso, Rodrigues Daniela Oliveira Werneck, Gaburo Junior Nelson, Kelly Shannon, Sabino Ester Cerdeira, |
Genetic Modifiers of Fetal Haemoglobin (HbF) and Phenotypic Severity in ß-Thalassemia Patients. Current molecular medicine 2018 Oct . Razak S A A, Murad N A A, Masra F, Chong D L S, Abdullah N, Jalil N, Alauddin H, Sabudin R Z A R, Ithnin A, Alias H, Khai L C, Aziz N A, Muda Z, Ibrahim H, Jamal R, Latif Z |
Molecular Spectrum of a- and ß-Thalassemia Mutations in a Large Ethnic Hakka Population in Southern China. Hemoglobin 2018 Jul 1-5. Zhao Pingsen, Weng Ruiqiang, Wu Hemi |
Factor V Leiden G1691A, Prothrombin G20210A, and MTHFR C677T and A1298C Mutations in Patients With Sickle Cell Disease in Tunisia. Hemoglobin 2018 Mar 42 (2): 96-102. Belhaj Nefissi Rim, Doggui Radhouene, Ouali Faida, Messaoud Taieb, Gritli Nasreddi |
Quantitative Trait Loci Influencing Hb F Levels in Southern Thai Hb E (HBB: c.79G>A) Heterozygotes. Hemoglobin 2018 Feb 1-7. Kesornsit Aumpika, Jeenduang Nutjaree, Horpet Dararat, Plyduang Thunyaluk, Nuinoon Man |
Genetic Background of the Sickle Cell Disease Pediatric Population of Dakar, Senegal, and Characterization of a Novel Frameshift ß-Thalassemia Mutation [HBB: c.265_266del; p.Leu89Glufs*2]. Hemoglobin 2017 Jul 1-7. Gueye Tall Fatou, Martin Cyril, Malick Ndour El Hadji, Déme Ly Indou, Renoux Céline, Chillotti Louis, Veyrenche Nicolas, Connes Philippe, Madieye Gueye Papa, Ndiaye Diallo Rokhaya, Lacan Philippe, Diagne Ibrahima, Amadou Diop Pape, Cissé Aynina, Lopez Sall Philomène, Joly Philip |
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients. International journal of laboratory hematology 2017 Jun . Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y, Magaña-Torres M T, Rentería-López V M, Perea-Díaz F |
Mutational Profile of Homozygous ß-Thalassemia in Rio de Janeiro, Brazil. Hemoglobin 2017 Apr 1-4. Carrocini Gisele C S, Venancio Larissa P R, Pessoa Viviani L R, Lobo Clarisse L C, Bonini-Domingos Claudia |
The Frequency of HBB Mutations Among ß-Thalassemia Patients in Hamadan Province, Iran. Hemoglobin 2017 Apr 1-4. Jalilian Masoumeh, Azizi Jalilian Farid, Ahmadi Leila, Amini Razieh, Esfehani Hossein, Sosanian Maryam, Rabbani Bahareh, Maleki Majid, Mahdieh Nej |
Xmn1-158 ?GVariant in B-Thalassemia Intermediate Patients in South-East of Iran. International journal of hematology-oncology and stem cell research 2017 Apr 11 (2): 165-171. Miri-Moghaddam Ebrahim, Bahrami Sara, Naderi Majid, Bazi Ali, Karimipoor Morte |
[Analysis of clinical phenotype and genotype of unstable Hemoglobin Rush]. Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2017 Feb 34 (1): 15-20. Ge Shijun, Yang Biqing, Yi Wei, Huang Kai, Liu Hongxian, Huang Xiaoqin, Chu Jiayou, Yang Zhaoqi |
Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population. Genetic testing and molecular biomarkers 2016 Nov . Panja Amrita, Chowdhury Prosanto, Chakraborty Sharmistha, Ghosh Tapan Kumar, Basu Anup |
Hb E-ß-Thalassemia in Five Indian States. Hemoglobin 2016 Sep 1-6. Italia Khushnooma, Dabke Pooja, Sawant Pratibha, Nadkarni Anita, Ghosh Kanjaksha, Colah Roshan |
Hb A Determination by Capillary Electrophoresis is an Efficient Method for Detecting ß-Thalassemias and Hemoglobin Variants. Hemoglobin 2016 Aug 1-13. Orts Juan A, Zúñiga Ángel, Bello Yanis, Fabregat Aleix B, Vicente Ana |
Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East. Blood reviews 2016 Jul . Mahdieh Nejat, Rabbani Bahar |
Prevalence and mutations of ß-thalassemia trait and abnormal hemoglobins in premarital screening in Çanakkale province, Turkey. Balkan journal of medical genetics : BJMG 2016 Jul 19 (1): 29-34. Uluda? A, Uysal A, Uluda? A, Ertekin Y H, Tekin M, Kütük B, Silan F, Özdemir |
Coinheritance of a Rare Nucleotide Substitution on the ß-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling. Hemoglobin 2016 Jun 1-5. Vinciguerra Margherita, Passarello Cristina, Leto Filippo, Crivello Anna, Fustaneo Maria, Cassarà Filippo, Cannata Monica, Maggio Aurelio, Giambona Antoni |
Molecular Characterization of ß-Thalassemia Intermedia in Southeast Iran. Hemoglobin 2016 Jun 40 (3): 173-8. Miri-Moghaddam Ebrahim, Bahrami Sara, Naderi Majid, Bazi Ali, Karimipoor Morte |
Setup of a Protocol of Molecular Diagnosis of ß-Thalassemia Mutations in Tunisia using Denaturing High-Performance Liquid Chromatography (DHPLC). Journal of clinical laboratory analysis 2016 Apr . Sahli Chaima Abdelhafidh, Ben Salem Ikbel, Jouini Latifa, Laouini Naouel, Dabboubi Rym, Hadj Fredj Sondes, Siala Hajer, Othmeni Rym, Dakhlaoui Boutheina, Fattoum Slaheddine, Bibi Amina, Messaoud Tai |
Hemoglobinopathies in the Çukurova Region and Neighboring Provinces. Hemoglobin 2016 Mar 1-5. Yuzbasioglu Ariyurek Sedefgul, Yildiz Sule Menziletoglu, Yalin Ali Erdinc, Guzelgul Figen, Aksoy Kiym |
Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China. Hemoglobin 2016 Mar 1-8. Han Luhao, Su Hai, Wu Hao, Jiang Weiying, Chen Suq |
- Page last reviewed:Jul 25, 2022
- Page last updated:Aug 03, 2022
- Content source: