HuGE Literature Finder
Records 1-100
|
Karyomapping in preimplantation genetic testing for ß-thalassemia combined with HLA matching: a systematic summary.
Journal of assisted reproduction and genetics 2019 Nov . Wang Jing, Lu Bao-Min, Li Rong, Guo Jing, Xu Yan, Pan Jia-Fu, Zeng Yan-Hong, Zhou Can-Quan, Xu Yan-W |
|
The Spectrum of ß-Thalassemia Mutations in Hamadan Province, West Iran.
Hemoglobin 2019 May 1-5. Alibakhshi Reza, Moradi Keivan, Aznab Mozaffar, Azimi Azam, Shafieenia Samaneh, Biglari Mosta |
|
Haplotype Analysis of Three Common ß-Thalassemia Mutations in Syrian Patients.
Hemoglobin 2019 Jan 1-4. Murad Hossam, Moassas Faten, Ghoury Ifad, Mukhalalaty Yass |
|
Use of an automated pyrosequencing technique for confirmation of sickle cell disease.
PloS one 2019 14 (12): e0216020. de Martino Camila Cruz, Alencar Cecilia Salete, Loureiro Paula, Carneiro-Proietti Anna Barbara de Freitas, Máximo Claudia de Alvarenga, Mota Rosimere Afonso, Rodrigues Daniela Oliveira Werneck, Gaburo Junior Nelson, Kelly Shannon, Sabino Ester Cerdeira, |
|
Genetic Modifiers of Fetal Haemoglobin (HbF) and Phenotypic Severity in ?-Thalassemia Patients.
Current molecular medicine 2018 Oct . Razak S A A, Murad N A A, Masra F, Chong D L S, Abdullah N, Jalil N, Alauddin H, Sabudin R Z A R, Ithnin A, Alias H, Khai L C, Aziz N A, Muda Z, Ibrahim H, Jamal R, Latif Z |
|
Molecular Spectrum of ?- and ?-Thalassemia Mutations in a Large Ethnic Hakka Population in Southern China.
Hemoglobin 2018 Jul 1-5. Zhao Pingsen, Weng Ruiqiang, Wu Hemi |
|
Genetic Background of the Sickle Cell Disease Pediatric Population of Dakar, Senegal, and Characterization of a Novel Frameshift ?-Thalassemia Mutation [HBB: c.265_266del; p.Leu89Glufs*2].
Hemoglobin 2017 Jul 1-7. Gueye Tall Fatou, Martin Cyril, Malick Ndour El Hadji, Déme Ly Indou, Renoux Céline, Chillotti Louis, Veyrenche Nicolas, Connes Philippe, Madieye Gueye Papa, Ndiaye Diallo Rokhaya, Lacan Philippe, Diagne Ibrahima, Amadou Diop Pape, Cissé Aynina, Lopez Sall Philomène, Joly Philip |
|
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ?-Thalassemia in Mexican mestizo patients.
International journal of laboratory hematology 2017 Jun . Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y, Magaña-Torres M T, Rentería-López V M, Perea-Díaz F |
|
Mutational Profile of Homozygous ?-Thalassemia in Rio de Janeiro, Brazil.
Hemoglobin 2017 Apr 1-4. Carrocini Gisele C S, Venancio Larissa P R, Pessoa Viviani L R, Lobo Clarisse L C, Bonini-Domingos Claudia |
|
The Frequency of HBB Mutations Among ?-Thalassemia Patients in Hamadan Province, Iran.
Hemoglobin 2017 Apr 1-4. Jalilian Masoumeh, Azizi Jalilian Farid, Ahmadi Leila, Amini Razieh, Esfehani Hossein, Sosanian Maryam, Rabbani Bahareh, Maleki Majid, Mahdieh Nej |
|
Xmn1-158 ?GVariant in B-Thalassemia Intermediate Patients in South-East of Iran.
International journal of hematology-oncology and stem cell research 2017 Apr 11 (2): 165-171. Miri-Moghaddam Ebrahim, Bahrami Sara, Naderi Majid, Bazi Ali, Karimipoor Morte |
|
[Analysis of clinical phenotype and genotype of unstable Hemoglobin Rush].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2017 Feb 34 (1): 15-20. Ge Shijun, Yang Biqing, Yi Wei, Huang Kai, Liu Hongxian, Huang Xiaoqin, Chu Jiayou, Yang Zhaoqi |
|
Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.
Genetic testing and molecular biomarkers 2016 Nov . Panja Amrita, Chowdhury Prosanto, Chakraborty Sharmistha, Ghosh Tapan Kumar, Basu Anup |
|
Premarital Genetic Diagnosis revealed Co-heredity of Beta globin gene 25-26 delAA and 3'UTR+101 G-C variants in two beta thalassemia heterozygotes.
Turkish journal of haematology : official journal of Turkish Society of Haematology 2016 Oct . Yararba? Kanay, Ard?ço?lu Yasemin, Akar Nej |
|
Hb E-?-Thalassemia in Five Indian States.
Hemoglobin 2016 Sep 1-6. Italia Khushnooma, Dabke Pooja, Sawant Pratibha, Nadkarni Anita, Ghosh Kanjaksha, Colah Roshan |
|
Hb A1c Determination by Capillary Electrophoresis is an Efficient Method for Detecting ?-Thalassemias and Hemoglobin Variants.
Hemoglobin 2016 Aug 1-13. Orts Juan A, Zúñiga Ángel, Bello Yanis, Fabregat Aleix B, Vicente Ana |
|
Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East.
Blood reviews 2016 Jul . Mahdieh Nejat, Rabbani Bahar |
|
Prevalence and mutations of ?-thalassemia trait and abnormal hemoglobins in premarital screening in Çanakkale province, Turkey.
Balkan journal of medical genetics : BJMG 2016 Jul 19 (1): 29-34. Uluda? A, Uysal A, Uluda? A, Ertekin Y H, Tekin M, Kütük B, Silan F, Özdemir |
|
Coinheritance of a Rare Nucleotide Substitution on the ?-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling.
Hemoglobin 2016 Jun 1-5. Vinciguerra Margherita, Passarello Cristina, Leto Filippo, Crivello Anna, Fustaneo Maria, Cassarà Filippo, Cannata Monica, Maggio Aurelio, Giambona Antoni |
|
Molecular Characterization of ?-Thalassemia Intermedia in Southeast Iran.
Hemoglobin 2016 Jun 40 (3): 173-8. Miri-Moghaddam Ebrahim, Bahrami Sara, Naderi Majid, Bazi Ali, Karimipoor Morte |
|
Setup of a Protocol of Molecular Diagnosis of ?-Thalassemia Mutations in Tunisia using Denaturing High-Performance Liquid Chromatography (DHPLC).
Journal of clinical laboratory analysis 2016 Apr . Sahli Chaima Abdelhafidh, Ben Salem Ikbel, Jouini Latifa, Laouini Naouel, Dabboubi Rym, Hadj Fredj Sondes, Siala Hajer, Othmeni Rym, Dakhlaoui Boutheina, Fattoum Slaheddine, Bibi Amina, Messaoud Tai |
|
Detection of ß-Thalassemia Mutations Using TaqMan Single Nucleotide Polymorphism Genotyping Assays.
Genetic testing and molecular biomarkers 2016 Mar 20 (3): 154-7. Alwazani Wissam A, Zahid Rawabi, Elaimi Aisha, Bajouh Osamah, Hindawi Salwa, Arab Badr, Damanhouri Ghazi, Saka Mohamad Yassin, Turki Rola, Khan Jalaluddin A, Dallol Ashraf, Abuzenadah Adel |
|
Hemoglobinopathies in the Çukurova Region and Neighboring Provinces.
Hemoglobin 2016 Mar 1-5. Yuzbasioglu Ariyurek Sedefgul, Yildiz Sule Menziletoglu, Yalin Ali Erdinc, Guzelgul Figen, Aksoy Kiym |
|
Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.
Hemoglobin 2016 Mar 1-8. Han Luhao, Su Hai, Wu Hao, Jiang Weiying, Chen Suq |
|
The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) ?(0) -thalassaemia homozygotes.
British journal of haematology 2016 Jan . Jiang Zhihua, Luo Hong-Yuan, Huang Shengwen, Farrell John J, Davis Lance, Théberge Roger, Benson Katherine A, Riolueang Suchada, Viprakasit Vip, Al-Allawi Nasir A S, Ünal Sule, Gümrük Fatma, Akar Nejat, Ba?ak A Nazli, Osorio Leonor, Badens Catherine, Pissard Serge, Joly Philippe, Campbell Andrew D, Gallagher Patrick G, Steinberg Martin H, Forget Bernard G, Chui David H |
|
?-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.
Hemoglobin 2015 Dec 1-12. Cherry Laudy, Calo Carla, Talmaci Rodica, Perrin Pascale, Gavrila Luci |
|
[Beta thalassemia intermedia: clinical characteristics and molecular analysis. Case series].
Archivos argentinos de pediatría 2015 Oct 113 (5): e294-8. Eandi Eberle Silvia, Pepe Carolina, Aguirre Fernando, Milanesio Berenice, Fernández Diego, Mansini Adrián, Chávez Alejandro, Sciuccati Gabriela, Díaz Lilian, Candás Andrea, Avalos Gómez Vanesa, Bonduel Mariana, Feliú Torres Auro |
|
Molecular Scanning of ?-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
Hemoglobin 2015 Oct 39 (5): 330-3. Rujito Lantip, Basalamah Muhammad, Mulatsih Sri, Sofro Abdul Salam |
|
The Spectrum of ?-Thalassemia Mutations in a Population from the Brazilian Amazon.
Hemoglobin 2015 Sep 1-5. Silva Aylla N L M, Cardoso Greice L, Cunha Daniele A, Diniz Isabela G, Santos Sidney E B, Andrade Gabriela B, Trindade Saide M S, Cardoso Maria do Socorro O, Francês Larissa T V M, Guerreiro João |
|
Molecular Epidemiological Investigation of Thalassemia in the Chengdu Region, Sichuan Province, Southwest China.
Hemoglobin 2015 Aug 1-5. Yu Xia, Yang Li-Ye, Yang Hui-Tian, Liu Cheng-Gui, Cao Deng-Cheng, Shen Wei, Yang Hui, Zhan Xiao-Fen, Li Jian, Xue Bing-Rong, Lin M |
|
Molecular Scanning of ?-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
Hemoglobin 2015 Aug 1-4. Rujito Lantip, Basalamah Muhammad, Mulatsih Sri, Sofro Abdul Salam |
|
Changes in hematological parameters in ?-thalassemia individuals co-inherited with erythroid Krüppel-like factor mutations.
Clinical genetics 2015 Jul 88 (1): 56-61. Yu L-H, Liu D, Cai R, Shang X, Zhang X-H, Ma X-X, Yan S-H, Fang P, Zheng C-G, Wei X-F, Liu Y-H, Zhou T-B, Xu X |
|
Novel ?eta (?)-Thalassemia Mutation in Turkish Children.
Indian journal of hematology & blood transfusion : an official journal of Indian Society of Hematology and Blood Transfusion 2015 Jun 31 (2): 218-22. Ulasli Mustafa, Oztuzcu Serdar, Kirkbes Sevil, Bay Ali, Igci Yusuf Ziya, Bayraktar Recep, Igci Mehri, Ergun Sercan, Cakmak Ecir Ali, Aytekin Elif, Arslan Ahm |
|
A genetic score for the prediction of beta-thalassemia severity.
Haematologica 2015 Apr 100 (4): 452-7. Danjou Fabrice, Francavilla Marcella, Anni Franco, Satta Stefania, Demartis Franca-Rosa, Perseu Lucia, Manca Matteo, Sollaino Maria Carla, Manunza Laura, Mereu Elisabetta, Marceddu Giuseppe, Pissard Serge, Joly Philippe, Thuret Isabelle, Origa Raffaella, Borg Joseph, Forni Gian Luca, Piga Antonio, Lai Maria Eliana, Badens Catherine, Moi Paolo, Galanello Ren |
|
Genetic basis of persistent red blood cell microcytosis in the Chinese unexplained by phenotypical testing.
Journal of clinical pathology 2015 Jan 68 (1): 69-72. So Chi-Chiu, Liu Ada K, Tsang Mandy H, Ngai Donna Y, Leung Kin-Sang, Chan Amy |
|
?-Globin Mutations in Egyptian Patients With ?-Thalassemia.
Laboratory medicine 2015 46 (1): 8-13. Elmezayen Ammar D, Kotb Samia M, Sadek Nadia A, Abdalla Ebtesam |
|
Coinheritance of Hb D-Punjab and ?-thalassemia: diagnosis and implications in prenatal diagnosis.
Hemoglobin 2015 39 (2): 138-40. Das Sheila, Mashon Ranjeet |
|
First Detection of a Splice Acceptor Site ?-Thalassemia Mutation: IVS-I-130 (HBB: c.93-1G?>?C) in a Chinese Patient.
Hemoglobin 2015 39 (4): 290-1. He Sheng, Zhang Qiang, Zheng Chenguang, Wei Yuan, Tang Yanqing, Chen Qiuli, Chen Shao |
|
Genetic determinants of ?-thalassemia intermedia in Pakistan.
Hemoglobin 2015 39 (2): 95-101. Khan Jabbar, Ahmad Nafees, Siraj Sami, Hoti Naserudd |
|
Molecular Basis of ?-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.
Hemoglobin 2015 39 (4): 230-4. Ozkinay Ferda, Onay Huseyin, Karaca Emin, Arslan Esra, Erturk Biray, Ece Solmaz Asli, Tekin Ismihan Merve, Cogulu Ozgur, Aydinok Ye?im, Vergin Can |
|
Occurrence of the Codon 24 (A?>?T) Mutation in the Mauritanian Population.
Hemoglobin 2015 39 (4): 296-7. Veten Fatimetou, Ghaber Sidi, Habti Nordine, Houmeida Ahm |
|
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.
Public health genomics 2015 18 (1): 60-4. Tan Jin-Ai M A, Chin Saw-Sian, Ong Gek-Bee, Mohamed Unni Mohamed N, Soosay Ashley E R, Gudum Henry R, Kho Siew-Leng, Chua Kek-Heng, Chen Jang J, George Elizabe |
|
Impact of ?-globin mutations on outcome of matched related donor hematopoietic stem cell transplantation for patients with ?-thalassemia major.
Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation 2014 Nov 20 (11): 1772-6. Hamidieh Amir Ali, Saber Tina, Fayyazi Shahrzad, Jalali Arash, Behfar Maryam, Hamdi Amir, Ghavamzadeh Ardesh |
|
[Analysis of ? -thalassemia mutations in Guizhou Province].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2014 Oct 31 (5): 561-4. Liu Xingmei, Su Li, Li Guifang, Wu Xian, Wang Rulei, Huang Shengw |
|
Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology.
Blood cells, molecules & diseases 2014 Sep 53 (3): 133-7. Hassan S M, Vossen R H A M, Chessa R, den Dunnen J T, Bakker E, Giordano P C, Harteveld C |
|
Influence of the ?s haplotype and ?-thalassemia on stroke development in a Brazilian population with sickle cell anaemia.
Annals of hematology 2014 Jul 93 (7): 1123-9. Domingos Igor F, Falcão Diego A, Hatzlhofer Betania L, Cunha Anderson F, Santos Magnun N, Albuquerque Dulcinéia M, Fertrin Kleber Y, Costa Fernando F, Azevedo Renata C, Machado Cíntia G, Araújo Aderson S, Lucena-Araujo Antonio R, Bezerra Marcos |
|
Descriptive profile of ?-thalassemia mutations in West Bengal population: a hospital-based study.
International journal of hematology 2014 Mar 99 (3): 345-53. Bhattacharyya Deboshree M, Mukhopadhyay Ashis, Basak Jayas |
|
Rapid and inexpensive detection of common HBB gene mutations in Tunisian population by high-resolution melting analysis: implication for molecular diagnosis.
Hematology (Amsterdam, Netherlands) 2014 Mar 19 (2): 80-4. Ouragini Houyem, Haddad Faten, Darragi Imen, Abbes Sal |
|
The associations of SEA-alpha thalassemia 1, XmnI-Ggamma polymorphism and beta-globin gene mutations with the clinical severity of beta-thalassemia syndrome in northern Thailand.
Journal of the Medical Association of Thailand = Chotmaihet thangphaet 2014 Mar 97 (3): 300-7. Tatu Thanusak, Sritong Waratip, Sa-Nguansermsri Torpo |
|
Chronic inflammatory state in sickle cell anemia patients is associated with HBB(*)S haplotype.
Cytokine 2014 Feb 65 (2): 217-21. Bandeira Izabel C J, Rocha Lillianne B S, Barbosa Maritza C, Elias Darcielle B D, Querioz José A N, Freitas Max Vitor Carioca, Gonçalves Romélia |
|
Extramedullary haematopoiesis correlates with genotype and absence of cardiac iron overload in polytransfused adults with thalassaemia.
Blood transfusion = Trasfusione del sangue 2014 Jan 12 Suppl 1 s124-30. Ricchi Paolo, Ammirabile Massimiliano, Spasiano Anna, Costantini Silvia, Di Matola Tiziana, Pepe Alessia, Cinque Patrizia, Pagano Leonilde, Casale Maddalena, Filosa Aldo, Prossomariti Lucia |
|
Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population.
Hemoglobin 2014 38 (1): 33-8. Sahoo Subhransu Sekhar, Biswal Sebaranjan, Dixit Manjus |
|
Effect of genotype on pulmonary hypertension risk in patients with thalassemia.
European journal of haematology 2014 92 (5): 429-34. Teawtrakul Nattiya, Ungprasert Phuangpaka, Pussadhamma Burabha, Prayalaw Patcharawadee, Fucharoen Supan, Jetsrisuparb Arunee, Pongudom Saranya, Sirijerachai Chittima, Chansung Kanchana, Wanitpongpun Chinadol, Chuncharunee Supo |
|
High resolution melting analysis: a rapid screening and typing tool for common ?-thalassemia mutation in Chinese population.
PloS one 2014 9 (8): e102243. Lin Min, Jiao Ji-Wei, Zhan Xiu-Hui, Zhan Xiao-Fen, Pan Mei-Chen, Wang Jun-Li, Wang Chun-Fang, Zhong Tian-Yu, Zhang Qin, Yu Xia, Wu Jiao-Ren, Yang Hui-Tian, Lin Fen, Tong Xin, Yang Hui, Zha Guang-Cai, Wang Qian, Zheng Lei, Wen Ying-Fang, Yang Li- |
|
Molecular characterization and phenotypical study of ?-thalassemia in Tucumán, Argentina.
Hemoglobin 2014 38 (6): 394-401. Lazarte Sandra S, Mónaco María E, Haro Ana C, Jiménez Cecilia L, Ledesma Achem Myriam E, Issé Blanca |
|
Molecular update of ?-thalassemia mutations in the Syrian population: identification of rare ?-thalassemia mutations.
Hemoglobin 2014 38 (4): 272-6. Jarjour Rami A, Murad Hossam, Moasses Faten, Al-Achkar Wal |
|
The prevalence and molecular spectrum of ?- and ?-globin gene mutations in 14,332 families of Guangdong Province, China.
PloS one 2014 9 (2): e89855. Yin Aihua, Li Bing, Luo Mingyong, Xu Longchang, Wu Li, Zhang Liang, Ma Yuanzhu, Chen Tingting, Gao Shuang, Liang Juqing, Guo Hao, Qin Danqing, Wang Jicheng, Yuan Tenglong, Wang Yixia, Huang Wei-wei, He Wen-Fei, Zhang Yanxia, Liu Chang, Xia Sujian, Chen Qingshan, Zhao Qingguo, Zhang Xiaozhua |
|
Next generation sequencing of SNPs for non-invasive prenatal diagnosis: challenges and feasibility as illustrated by an application to ?-thalassaemia.
European journal of human genetics : EJHG 2013 Dec 21 (12): 1403-10. Papasavva Thessalia, van Ijcken Wilfred F J, Kockx Christel E M, van den Hout Mirjam C G N, Kountouris Petros, Kythreotis Loukas, Kalogirou Eleni, Grosveld Frank G, Kleanthous Mari |
|
Prevalence and genetic analysis of ?-thalassemia and ?-thalassemia in Chongqing area of China.
Gene 2013 Dec 532 (1): 120-4. Yao Xiu-Yun, Yu Jie, Chen Shi-Ping, Xiao Jian-Wen, Zheng Qi-Chen, Liu Hai-Yan, Zhang Lei, Xian Ying, Zou L |
|
Spectrum of ?-thalassemia mutations in Guizhou Province, PR China, including first observation of codon 121 (GAA>TAA) in Chinese population.
Clinical biochemistry 2013 Dec 46 (18): 1865-8. Huang Sheng-Wen, Liu Xing-Mei, Li Gui-Fang, Su Li, Wu Xian, Wang Ru-L |
|
Association between clinical expression and molecular heterogeneity in ?-thalassemia Tunisian patients.
Molecular biology reports 2013 Nov 40 (11): 6205-12. Jouini L, Sahli C A, Laaouini N, Ouali F, Ben Youssef I, Dakhlaoui B, Othmeni R, Ouennich F, Hadj Fredj S, Siala H, Becher M, Toumi N E, Fattoum S, Hafsia R, Bibi A, Messaoud |
|
Rapid prenatal diagnosis of common beta-thalassemia mutations in Southeast Asia using pyrosequencing.
Prenatal diagnosis 2013 Nov 33 (11): 1017-22. Ho Sherry Sze Yee, Huan Pei Tee, Leow Gek Har, Ching Leng Kee, Chiu Lily, Law Hai Yang, Koay Evelyn S |
|
The effect of HFE polymorphisms on cardiac iron overload in patients with beta-thalassemia major.
Pediatric hematology and oncology 2013 Nov 30 (8): 755-60. Turedi Aysen, Oymak Yesim, Me?e Timur, Yaman Yöntem, Bayraktaroglu Selen, Alpman Asude, Ozkinay Ferda, Ayd?nok Ye?im, Vergin Can |
|
Frequency and spectrum of hemoglobinopathy mutations in a Uruguayan pediatric population.
Genetics and molecular biology 2013 Sep 36 (3): 316-22. Luz Julio Da, Avila Amalia, Icasuriaga Sandra, Gongóra María, Castillo Luis, Serrón Alejandra, Kimura Elza Miyuki, Costa Fernando Ferreira, Sans Mónica, Sonati Maria de Fáti |
|
Problems in determining thalassemia carrier status in a program for prevention and control of severe thalassemia syndromes: a lesson from Thailand.
Clinical chemistry and laboratory medicine : CCLM / FESCC 2013 Aug 51 (8): 1605-14. Viprakasit Vip, Limwongse Chanin, Sukpanichnant Sathein, Ruangvutilert Pornpimol, Kanjanakorn Chompunut, Glomglao Waraporn, Sirikong Monchan, Utto Witayakarn, Tanphaichitr Voravarn |
|
The influence of the BCL11A polymorphism on the phenotype of patients with beta thalassemia could be affected by the beta globin locus control region and/or the Xmn1-HBG2 genotypic background.
Blood cells, molecules & diseases 2013 Aug 51 (2): 80-4. Neishabury Maryam, Zamani Fahimeh, Keyhani Elahe, Azarkeivan Azita, Abedini Seyedeh Sedigheh, Eslami Masumeh Sadat, Kakroodi Setareh Talebi, Vesiehsari Mahjoobeh Jafari, Najmabadi Hosse |
|
[Prevalence and molecular analysis of ?-thalassemia in children of Han ethnicity in Chongqing city].
Zhonghua er ke za zhi. Chinese journal of pediatrics 2013 Jul 51 (7): 7. Yao XY, Zhang YM, Qin ZZ, Fan R, Zou L, Chen SP, Zhang L, Xie Q, Zhong XY, Xian Y, Yu J |
|
A Minimal Set of SNPs for the Noninvasive Prenatal Diagnosis of ?-Thalassaemia.
Annals of human genetics 2013 Jan . Papasavva TE, Lederer CW, Traeger-Synodinos J, Mavrou A, Kanavakis E, Ioannou C, Makariou C, Kleanthous M |
|
Hemoglobinopathy carrier prevalence in the United Arab Emirates: first analysis of the Dubai Health Authority premarital screening program results.
Hemoglobin 2013 37 (4): 359-68. Belhoul Khawla M, Abdulrahman Mahera, Alraei Rafeeiah |
|
High throughput molecular confirmation of ?-thalassemia mutations using novel TaqMan probes.
Sensors (Basel, Switzerland) 2013 13 (2): 2506-14. Kho Siew Leng, Chua Kek Heng, George Elizabeth, Tan Jin Ai Mary An |
|
Molecular spectrum of ?-thalassemia in Fujian Province, Southeastern China.
Hemoglobin 2013 37 (4): 343-50. Huang Hailong, Xu Liangpu, Lin Na, He Deqin, Li Yin, Guo Danhua, Wang Linshuo, Wang Yan, Zhen Lin, Xu Jinbang, Lin Yu |
|
Prevalence and molecular characterization of ?-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil.
Hemoglobin 2013 37 (3): 285-90. Fonseca Silvana F, Moura Neto Jose P, Goncalves Marilda |
|
Specific and straightforward molecular investigation of ?-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.
Genetics and molecular research : GMR 2013 12 (3): 2409-15. Kho S L, Chua K H, George E, Tan J A M |
|
The spectrum of ?-thalassemia mutations in Baghdad, Central Iraq.
Hemoglobin 2013 37 (5): 444-53. Al-Allawi Nasir A S, Al-Mousawi Bassam M S, Badi Ameer I A, Jalal Sana |
|
The spectrum of ?-thalassemia mutations in Kermanshah Province in West Iran and its association with hematological parameters.
Hemoglobin 2013 37 (6): 544-52. Mehrabi Masomeh, Alibakhshi Reza, Fathollahi Soheila, Farshchi Mohammad Re |
|
Prevalence of ?-Thalassemia and hemoglobin E in two migrant populations of Manipur, North East India.
Genetic testing and molecular biomarkers 2012 Oct 16 (10): 1195-200. Achoubi Nongthombam, Asghar Mohammad, Saraswathy Kallur Nava, Murry Benrithu |
|
Genetic modifiers of ?-thalassemia and clinical severity as assessed by age at first transfusion.
Haematologica 2012 Jul 97 (7): 989-93. Danjou Fabrice, Anni Franco, Perseu Lucia, Satta Stefania, Dessì Carlo, Lai Maria Eliana, Fortina Paolo, Devoto Marcella, Galanello Ren |
|
The alpha-globin genotype does not influence sickle cell disease severity in a retrospective cross-validation study of the pediatric severity score.
European journal of haematology 2012 Jan 88 (1): 61-7. Joly Philippe, Pondarré Corinne, Bardel Claire, Francina Alain, Martin Cyr |
|
A single nucleotide polymorphism in the HBBP1 gene in the human ?-globin locus is associated with a mild ?-thalassemia disease phenotype.
Hemoglobin 2012 36 (5): 433-45. Giannopoulou Emily, Bartsakoulia Marina, Tafrali Christina, Kourakli Alexandra, Poulas Konstantinos, Stavrou Eleana F, Papachatzopoulou Adamantia, Georgitsi Marianthi, Patrinos George |
|
Influences of genetic variation on fetal hemoglobin.
Pediatric hematology and oncology 2011 Nov 28 (8): 708-17. He Yunyan, Lin Weixiong, Luo Jianmi |
|
Variants in genetic modifiers of ?-thalassemia can help to predict the major or intermedia type of the disease.
Haematologica 2011 Nov 96 (11): 1712-4. Badens Catherine, Joly Philippe, Agouti Imane, Thuret Isabelle, Gonnet Katia, Fattoum Synda, Francina Alain, Simeoni Marie-Claude, Loundou Anderson, Pissard Ser |
|
A melting curve analysis--based PCR assay for one-step genotyping of ?-thalassemia mutations a multicenter validation.
The Journal of molecular diagnostics : JMD 2011 Jul 13 (4): 427-35. Xiong Fu, Huang Qiuying, Chen Xiaoyun, Zhou Yuqiu, Zhang Xinhua, Cai Ren, Chen Yajun, Xie Jiansheng, Feng Shanwei, Wei Xiaofeng, Xiao Qizhi, Zhang Tianlang, Luo Shiqiang, Yang Xuehuang, Hao Ying, Qu Yanxia, Li Qingge, Xu Xiangm |
|
Plasma lipids and lipoproteins in children and young adults with major ?-thalassemia from western Iran: influence of genotype.
Molecular biology reports 2011 Apr 38 (4): 2573-8. Madani Hamid, Rahimi Zohreh, Manavi-Shad Mohammad, Mozafari Hadi, Akramipour Reza, Vaisi-Raygani Asad, Rezaei Mansour, Malek-Khosravi Shohreh, Shakiba Ebrahim, Parsian Abb |
|
The association between intragenic SNP haplotypes and mutations of the beta globin gene in a Turkish population.
Blood cells, molecules & diseases 2011 Mar 46 (3): 226-9. Bilgen Turker, Arikan Yunus, Canatan Duran, Ye?ilipek Akif, Keser Ibrah |
|
Genetics of fetal hemoglobin in Tanzanian and British patients with sickle cell anemia.
Blood 2011 Jan 117 (4): 1390-2. Makani Julie, Menzel Stephan, Nkya Siana, Cox Sharon E, Drasar Emma, Soka Deogratius, Komba Albert N, Mgaya Josephine, Rooks Helen, Vasavda Nisha, Fegan Gregory, Newton Charles R, Farrall Martin, Thein Swee L |
|
Elevated hemoglobin A2 as a marker for ?-thalassemia trait in pregnant women.
The Tohoku journal of experimental medicine 2011 223 (3): 223-6. Ou Zhanhui, Li Qing, Liu Weiqiang, Sun Xiaofa |
|
Molecular analysis of ?-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
Hemoglobin 2011 35 (4): 358-66. Fernandes Andrea Cristina, Shimmoto Marily Maria Azevedo, Furuzawa Gilberto Koiti, Vicari Perla, Figueiredo Maria Stel |
|
[Genetic analysis of ? -thalassemia mutations in the minority populations of Guizhou province].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2010 Dec 27 (6): 700-3. Yu Fang, Zhong Chunli, Zhou Qiang, Yang Yuan, Li Wei, Liu Bing, Pan Shaojin, Tang Kaiyuan, Fang Rong, Jin Weij |
|
Rapid identification of common ?-thalassemia mutations in the Chinese population using duplex or triplex amplicon genotyping by high-resolution melting analysis.
Genetic testing and molecular biomarkers 2010 Dec 14 (6): 851-6. He Xiang, Sheng Min, Xu Miao, Xiong Can, Ren Zhaor |
|
Relative protection from ischaemic heart disease in beta-thalassaemia carriers.
Journal of the College of Physicians and Surgeons--Pakistan : JCPSP 2010 Oct 20 (10): 653-6. Bozdar Manzar, Ahmed Suhaib, Anwar Jale |
|
Age, beta thalassaemia trait, and iron-deficient anaemia significantly affect reticulocyte indices in pre-school children.
European journal of pediatrics 2010 Sep 169 (9): 1097-104. Chouliaras Giorgos L, Stamoulakatou Alexandra, Tsiftis George, Perissaki Georgia, Premetis Evangelos, Lycopoulou Lil |
|
Alpha-thalassemia is associated with a decreased occurrence and a delayed age-at-onset of albuminuria in sickle cell anemia patients.
Blood cells, molecules & diseases 2010 Aug 45 (2): 154-8. Nebor Danitza, Broquere Cédric, Brudey Karine, Mougenel Danielle, Tarer Vanessa, Connes Philippe, Elion Jacques, Romana Ma |
|
Epidemiology of beta-thalassaemia in Western India: mapping the frequencies and mutations in sub-regions of Maharashtra and Gujarat.
British journal of haematology 2010 Jun 149 (5): 739-47. Colah Roshan, Gorakshakar Ajit, Phanasgaonkar Supriya, D'Souza Edna, Nadkarni Anita, Surve Reema, Sawant Pratibha, Master Dilip, Patel Ramesh, Ghosh Kanjaksha, Mohanty Dipi |
|
Reverse hybridization StripAssay detection of beta-thalassemia mutations in northeast Egypt.
Hematology (Amsterdam, Netherlands) 2010 Jun 15 (3): 182-6. Soliman Othman E, Yahia Sohier, Shouma Amany, Shafiek Hala K, Fouda Ashraf E, Azzam Hanan, Abousamra Nashwa K, Mahfouz Rabab, Goda Enas F, El-Sharawy Solafa |
|
Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study.
BMC medical genetics 2010 11 . Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA |
|
Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques.
Molecular biology reports 2010 Jan 37 (1): 149-54. Rahimi Zohreh, Muniz Adriana, Parsian Abb |
|
The Xmn1 polymorphic site 5' to the (G)gamma gene and its correlation to the (G)gamma:(A)gamma ratio, age at first blood transfusion and clinical features in beta-thalassemia patients from Western Iran.
Molecular biology reports 2010 Jan 37 (1): 159-64. Nemati Hooshang, Rahimi Zohreh, Bahrami Gholamre |
|
The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity.
BMC medical genetics 2010 11 (1): 31. Chen Wanqun, Zhang Xinhua, Shang Xuan, Cai Ren, Li Liyan, Zhou Tianhong, Sun Manna, Xiong Fu, Xu Xiangm |
|
Hydroxyurea-induced hematological response in transfusion-independent beta-thalassemia intermedia: case series and review of literature.
Pediatric hematology and oncology 2009 Nov 26 (8): 560-5. Ehsani Mohammad Ali, Hedayati-Asl Amir Abbas, Bagheri Alireza, Zeinali Syrus, Rashidi Arm |
|
[Study on the incidence of beta-Thalassemia and genotypes among children under 7 year-olds in Nanning, Liuzhou and Baise areas, Guangxi province].
Zhonghua liu xing bing xue za zhi = Zhonghua liuxingbingxue zazhi 2009 Oct 30 (10): 1021-4. Qiu Xiao-qiang, Chen Ping, Zhang Ning, Zeng Xiao-yun, Huang Cai-qian, Chen Wen-qiang, Lin Wei-xiong, Li Shu-qu |
- Page last reviewed:Jul 30, 2019
- Page last updated:Jan 23, 2020
- Content source: