Human Genome Epidemiology Literature Finder
|
Records 1 - 23 (of 23 Records) |
| Query Trace: beta-Thalassemia and HBB[original query] |
|---|
| Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC. Human mutation 2003 Oct 22 (4): 326-36. Su Yi-Ning, Lee Chien-Nan, Hung Chia-Cheng, Chen Chi-An, Cheng Wen-Fang, Tsao Po-Nien, Yu Chia-Li, Hsieh Fon-J |
| Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations. BMC biotechnology 2008 8 (1): 62. Hung Chia-Cheng, Su Yi-Ning, Lin Chia-Yun, Chang Yin-Fei, Chang Chien-Hui, Cheng Wen-Fang, Chen Chi-An, Lee Chien-Nan, Lin Win- |
| Significance of borderline hemoglobin A2 values in an Italian population with a high prevalence of beta-thalassemia. Haematologica 2008 Sep 93 (9): 1380-4. Giambona Antonino, Passarello Cristina, Vinciguerra Margherita, Li Muli Rita, Teresi Pietro, Anzà Maurizio, Ruggeri Gaetano, Renda Disma, Maggio Aurel |
| Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations. The Journal of molecular diagnostics : JMD 2009 Jul 11 (4): 334-46. Thongnoppakhun Wanna, Jiemsup Surasak, Yongkiettrakul Suganya, Kanjanakorn Chompunut, Limwongse Chanin, Wilairat Prapon, Vanasant Anusorn, Rungroj Nanyawan, Yenchitsomanus Pa-Th |
| Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology. Blood cells, molecules & diseases 2014 Sep 53 (3): 133-7. Hassan S M, Vossen R H A M, Chessa R, den Dunnen J T, Bakker E, Giordano P C, Harteveld C |
| A genetic score for the prediction of beta-thalassemia severity. Haematologica 2015 Apr 100 (4): 452-7. Danjou Fabrice, Francavilla Marcella, Anni Franco, Satta Stefania, Demartis Franca-Rosa, Perseu Lucia, Manca Matteo, Sollaino Maria Carla, Manunza Laura, Mereu Elisabetta, Marceddu Giuseppe, Pissard Serge, Joly Philippe, Thuret Isabelle, Origa Raffaella, Borg Joseph, Forni Gian Luca, Piga Antonio, Lai Maria Eliana, Badens Catherine, Moi Paolo, Galanello Ren |
| [Beta thalassemia intermedia: clinical characteristics and molecular analysis. Case series]. Archivos argentinos de pediatría 2015 Oct 113 (5): e294-8. Eandi Eberle Silvia, Pepe Carolina, Aguirre Fernando, Milanesio Berenice, Fernández Diego, Mansini Adrián, Chávez Alejandro, Sciuccati Gabriela, Díaz Lilian, Candás Andrea, Avalos Gómez Vanesa, Bonduel Mariana, Feliú Torres Auro |
| Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East. Blood reviews 2016 Jul . Mahdieh Nejat, Rabbani Bahar |
| Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients. International journal of laboratory hematology 2017 Jun . Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y, Magaña-Torres M T, Rentería-López V M, Perea-Díaz F |
| Genotype-phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis. Journal of blood medicine 2018 4 9 35-41. Traivaree Chanchai, Monsereenusorn Chalinee, Rujkijyanont Piya, Prasertsin Warakorn, Boonyawat Boonch |
| Common fetal hemoglobin variants in Lebanese patients bearing the codon 29 beta gene mutation associated with different thalassemia phenotypes. Annals of hematology 2018 12 98 (4): 833-840. Brancaleoni Valentina, Moukhadder Hassan M, Consonni Dario, Koussa Suzanne, Di Pierro Elena, Cappellini Maria Domenica, Taher A |
| Borderline hemoglobin A levels in northern Thai population: HBB genotypes and effects of coinherited alpha-thalassemia. Blood cells, molecules & diseases 2018 10 74 13-17. Chaweephisal Phumin, Phusua Arunee, Fanhchaksai Kanda, Sirichotiyakul Supatra, Charoenkwan Piml |
| High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh. BMC genetics 2018 1 19 (1): 1. Islam Md Tarikul, Sarkar Suprovath Kumar, Sultana Nusrat, Begum Mst Noorjahan, Bhuyan Golam Sarower, Talukder Shezote, Muraduzzaman A K M, Alauddin Md, Islam Mohammad Sazzadul, Biswas Pritha Promita, Biswas Aparna, Qadri Syeda Kashfi, Shirin Tahmina, Banu Bilquis, Sadya Salma, Hussain Manzoor, Sarwardi Golam, Khan Waqar Ahmed, Mannan Mohammad Abdul, Shekhar Hossain Uddin, Chowdhury Emran Kabir, Sajib Abu Ashfaqur, Akhteruzzaman Sharif, Qadri Syed Saleheen, Qadri Firdausi, Mannoor Kaiiss |
| Use of an automated pyrosequencing technique for confirmation of sickle cell disease. PloS one 2019 14 (12): e0216020. de Martino Camila Cruz, Alencar Cecilia Salete, Loureiro Paula, Carneiro-Proietti Anna Barbara de Freitas, Máximo Claudia de Alvarenga, Mota Rosimere Afonso, Rodrigues Daniela Oliveira Werneck, Gaburo Junior Nelson, Kelly Shannon, Sabino Ester Cerdeira, |
| [Effect of high-throughput sequencing for the prevention and control of thalassemia]. Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2020 5 37 (6): 645-649. Chen Yang, Zhang Shufang, Wang Chan, Chen Shiping, Feng Nyu, Liu Haifang, Tang Xiaoyan, Wang J |
| Evidence of new intragenic HBB haplotypes model for the prediction of beta-thalassemia in the Malaysian population. Scientific reports 2021 8 11 (1): 16772. Aziz Nur-Aisyah, Taib Wan-Rohani Wan, Kharolazaman Nur-Khairunnisa, Ismail Imilia, Al-Jamal Hamid Ali Nagi, Jamil Nadiah Wan-Arfah Wan Abdul, Esa Ezalia, Ibrahim Hishamsh |
| A Cross-Sectional Study of Detection of Beta Globin (HBB) Haplotypes Among Beta Thalassemia Patients. Cureus 2021 Feb 13 (2): e13367. Alsamiri Ali, Alzahrani Fatma, Filimban Najlaa, Khojah Ammar, Felimban Raed, Qadah Tal |
| Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients. Genetic testing and molecular biomarkers 2021 3 25 (3): 247-252. Rizo-de la Torre Lourdes Del Carmen, Rentería-López Víctor Manuel, Sánchez-López Josefina Yoaly, Magaña-Torres María Teresa, Ibarra-Cortés Bertha, Perea-Díaz Francisco Javi |
| A Novel Frameshift Mutation, Deletion of HBB:c.199_202delAAAG [Codon 66/67 (-AAAG)] in ?-Thalassemia Major Patients from the Western Region of Uttar Pradesh, India. The application of clinical genetics 2021 14 77-85. Chauhan Waseem, Afzal Mohammad, Zaka-Ur-Rab Zeeba, Noorani Md Sal |
| Analysis of Common Beta-Thalassemia (?-Thalassemia) Mutations in East Java, Indonesia. Frontiers in pediatrics 2022 10 925599. Hernaningsih Yetti, Syafitri Yuli, Indrasari Yulia Nadar, Rahmawan Prafa Alif, Andarsini Mia Ratwita, Lesmana Indra, Moses Emmanuel Jairaj, Abdul Rahim Nur Arzuar, Yusoff Narazah Mo |
| The Spectrum of HBB Mutations among 2315 Beta Thalassemia Patients of a Reference Clinic in Tehran-Iran. Hemoglobin 2023 8 1-5. Niloofar Bazazzadegan, Seyedeh Sedigheh Abedini, Azita Azarkeivan, Susan Banihashemi, Nooshin Nikzat, Hossein Najmabadi, Maryam Neishabu |
| Clinical significance of mutational variants in beta and alpha genes in patients with hemoglobinopathies from two large Greek centers: a complex interplay between genotype and phenotype. Journal of molecular medicine (Berlin, Germany) 2023 7 . Michael D Diamantidis, Rebecca-Anastasia Karanikola, Chrysoula Polyzoudi, Sophia Delicou, Achilles Manafas, Helen Savera, Aikaterini Xydaki, Angeliki Kotsiafti, Evangelos Tsangalas, Georgia Ikonomou, Eirini Mani, Konstantinos Ntoulas, Evangelos Alexiou, Ioanna Argyrakouli, John Koskinas, Paraskevi Foti |
| Mutation Spectrum of ?-Thalassemia in Some Ethnic Groups of North Maharashtra, India. Hemoglobin 2023 6 1-6. Ranjeet Kumar, Syed Abrar Ahmad, Mustafa Ozdemir, Sakthivel Sadayappan, Varsha Wankha |
- Page last reviewed:Oct 1, 2023
- Page last updated:Dec 04, 2023
- Content source: