HuGE Literature Finder
Records 1-100
|
Molecular and geographical heterogeneity of hemoglobinopathy mutations in Azerbaijanian populations.
Annals of human genetics 2019 Nov . Aliyeva Gunay, Asadov Chingiz, Mammadova Tahira, Gafarova Surmaya, Guliyeva Yegana, Abdulalimov Eld |
|
Genetic Modifiers of Fetal Haemoglobin (HbF) and Phenotypic Severity in ?-Thalassemia Patients.
Current molecular medicine 2018 Oct . Razak S A A, Murad N A A, Masra F, Chong D L S, Abdullah N, Jalil N, Alauddin H, Sabudin R Z A R, Ithnin A, Alias H, Khai L C, Aziz N A, Muda Z, Ibrahim H, Jamal R, Latif Z |
|
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ?-Thalassemia in Mexican mestizo patients.
International journal of laboratory hematology 2017 Jun . Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y, Magaña-Torres M T, Rentería-López V M, Perea-Díaz F |
|
The Frequency of HBB Mutations Among ?-Thalassemia Patients in Hamadan Province, Iran.
Hemoglobin 2017 Apr 1-4. Jalilian Masoumeh, Azizi Jalilian Farid, Ahmadi Leila, Amini Razieh, Esfehani Hossein, Sosanian Maryam, Rabbani Bahareh, Maleki Majid, Mahdieh Nej |
|
Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.
Genetic testing and molecular biomarkers 2016 Nov . Panja Amrita, Chowdhury Prosanto, Chakraborty Sharmistha, Ghosh Tapan Kumar, Basu Anup |
|
Premarital Genetic Diagnosis revealed Co-heredity of Beta globin gene 25-26 delAA and 3'UTR+101 G-C variants in two beta thalassemia heterozygotes.
Turkish journal of haematology : official journal of Turkish Society of Haematology 2016 Oct . Yararba? Kanay, Ard?ço?lu Yasemin, Akar Nej |
|
Coinheritance of a Rare Nucleotide Substitution on the ?-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling.
Hemoglobin 2016 Jun 1-5. Vinciguerra Margherita, Passarello Cristina, Leto Filippo, Crivello Anna, Fustaneo Maria, Cassarà Filippo, Cannata Monica, Maggio Aurelio, Giambona Antoni |
|
Setup of a Protocol of Molecular Diagnosis of ?-Thalassemia Mutations in Tunisia using Denaturing High-Performance Liquid Chromatography (DHPLC).
Journal of clinical laboratory analysis 2016 Apr . Sahli Chaima Abdelhafidh, Ben Salem Ikbel, Jouini Latifa, Laouini Naouel, Dabboubi Rym, Hadj Fredj Sondes, Siala Hajer, Othmeni Rym, Dakhlaoui Boutheina, Fattoum Slaheddine, Bibi Amina, Messaoud Tai |
|
Sickle Cell Disease in Central India: A Potentially Severe Syndrome.
Indian journal of pediatrics 2016 Apr . Jain Dipty, Warthe Vinit, Dayama Paridhi, Sarate Dilip, Colah Roshan, Mehta Pallavi, Serjeant Grah |
|
Detection of ß-Thalassemia Mutations Using TaqMan Single Nucleotide Polymorphism Genotyping Assays.
Genetic testing and molecular biomarkers 2016 Mar 20 (3): 154-7. Alwazani Wissam A, Zahid Rawabi, Elaimi Aisha, Bajouh Osamah, Hindawi Salwa, Arab Badr, Damanhouri Ghazi, Saka Mohamad Yassin, Turki Rola, Khan Jalaluddin A, Dallol Ashraf, Abuzenadah Adel |
|
The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) ?(0) -thalassaemia homozygotes.
British journal of haematology 2016 Jan . Jiang Zhihua, Luo Hong-Yuan, Huang Shengwen, Farrell John J, Davis Lance, Théberge Roger, Benson Katherine A, Riolueang Suchada, Viprakasit Vip, Al-Allawi Nasir A S, Ünal Sule, Gümrük Fatma, Akar Nejat, Ba?ak A Nazli, Osorio Leonor, Badens Catherine, Pissard Serge, Joly Philippe, Campbell Andrew D, Gallagher Patrick G, Steinberg Martin H, Forget Bernard G, Chui David H |
|
A genetic score for the prediction of beta-thalassemia severity.
Haematologica 2015 Apr 100 (4): 452-7. Danjou Fabrice, Francavilla Marcella, Anni Franco, Satta Stefania, Demartis Franca-Rosa, Perseu Lucia, Manca Matteo, Sollaino Maria Carla, Manunza Laura, Mereu Elisabetta, Marceddu Giuseppe, Pissard Serge, Joly Philippe, Thuret Isabelle, Origa Raffaella, Borg Joseph, Forni Gian Luca, Piga Antonio, Lai Maria Eliana, Badens Catherine, Moi Paolo, Galanello Ren |
|
First report of the spectrum of ?-globin gene mutations in Omani subjects - identification of novel mutations.
International journal of laboratory hematology 2015 Apr 37 (2): 238-43. Alkindi S, AlZadjali S, Daar S, Ambusaidi R, Gravell D, Al Haddabi H, Krishnamoorthy R, Pathare |
|
Genetic basis of persistent red blood cell microcytosis in the Chinese unexplained by phenotypical testing.
Journal of clinical pathology 2015 Jan 68 (1): 69-72. So Chi-Chiu, Liu Ada K, Tsang Mandy H, Ngai Donna Y, Leung Kin-Sang, Chan Amy |
|
Characterization of Hb Lepore variants in the UK population.
Hemoglobin 2015 39 (1): 58-61. Guo Lina, Kausar Anika, Old John M, Henderson Shirley J, Gallienne Alice |
|
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.
Public health genomics 2015 18 (1): 60-4. Tan Jin-Ai M A, Chin Saw-Sian, Ong Gek-Bee, Mohamed Unni Mohamed N, Soosay Ashley E R, Gudum Henry R, Kho Siew-Leng, Chua Kek-Heng, Chen Jang J, George Elizabe |
|
Impact of ?-globin mutations on outcome of matched related donor hematopoietic stem cell transplantation for patients with ?-thalassemia major.
Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation 2014 Nov 20 (11): 1772-6. Hamidieh Amir Ali, Saber Tina, Fayyazi Shahrzad, Jalali Arash, Behfar Maryam, Hamdi Amir, Ghavamzadeh Ardesh |
|
[Analysis of ? -thalassemia mutations in Guizhou Province].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2014 Oct 31 (5): 561-4. Liu Xingmei, Su Li, Li Guifang, Wu Xian, Wang Rulei, Huang Shengw |
|
Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology.
Blood cells, molecules & diseases 2014 Sep 53 (3): 133-7. Hassan S M, Vossen R H A M, Chessa R, den Dunnen J T, Bakker E, Giordano P C, Harteveld C |
|
Influence of the ?s haplotype and ?-thalassemia on stroke development in a Brazilian population with sickle cell anaemia.
Annals of hematology 2014 Jul 93 (7): 1123-9. Domingos Igor F, Falcão Diego A, Hatzlhofer Betania L, Cunha Anderson F, Santos Magnun N, Albuquerque Dulcinéia M, Fertrin Kleber Y, Costa Fernando F, Azevedo Renata C, Machado Cíntia G, Araújo Aderson S, Lucena-Araujo Antonio R, Bezerra Marcos |
|
Descriptive profile of ?-thalassemia mutations in West Bengal population: a hospital-based study.
International journal of hematology 2014 Mar 99 (3): 345-53. Bhattacharyya Deboshree M, Mukhopadhyay Ashis, Basak Jayas |
|
Rapid and inexpensive detection of common HBB gene mutations in Tunisian population by high-resolution melting analysis: implication for molecular diagnosis.
Hematology (Amsterdam, Netherlands) 2014 Mar 19 (2): 80-4. Ouragini Houyem, Haddad Faten, Darragi Imen, Abbes Sal |
|
The associations of SEA-alpha thalassemia 1, XmnI-Ggamma polymorphism and beta-globin gene mutations with the clinical severity of beta-thalassemia syndrome in northern Thailand.
Journal of the Medical Association of Thailand = Chotmaihet thangphaet 2014 Mar 97 (3): 300-7. Tatu Thanusak, Sritong Waratip, Sa-Nguansermsri Torpo |
|
Extramedullary haematopoiesis correlates with genotype and absence of cardiac iron overload in polytransfused adults with thalassaemia.
Blood transfusion = Trasfusione del sangue 2014 Jan 12 Suppl 1 s124-30. Ricchi Paolo, Ammirabile Massimiliano, Spasiano Anna, Costantini Silvia, Di Matola Tiziana, Pepe Alessia, Cinque Patrizia, Pagano Leonilde, Casale Maddalena, Filosa Aldo, Prossomariti Lucia |
|
Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population.
Hemoglobin 2014 38 (1): 33-8. Sahoo Subhransu Sekhar, Biswal Sebaranjan, Dixit Manjus |
|
Effect of genotype on pulmonary hypertension risk in patients with thalassemia.
European journal of haematology 2014 92 (5): 429-34. Teawtrakul Nattiya, Ungprasert Phuangpaka, Pussadhamma Burabha, Prayalaw Patcharawadee, Fucharoen Supan, Jetsrisuparb Arunee, Pongudom Saranya, Sirijerachai Chittima, Chansung Kanchana, Wanitpongpun Chinadol, Chuncharunee Supo |
|
High resolution melting analysis: a rapid screening and typing tool for common ?-thalassemia mutation in Chinese population.
PloS one 2014 9 (8): e102243. Lin Min, Jiao Ji-Wei, Zhan Xiu-Hui, Zhan Xiao-Fen, Pan Mei-Chen, Wang Jun-Li, Wang Chun-Fang, Zhong Tian-Yu, Zhang Qin, Yu Xia, Wu Jiao-Ren, Yang Hui-Tian, Lin Fen, Tong Xin, Yang Hui, Zha Guang-Cai, Wang Qian, Zheng Lei, Wen Ying-Fang, Yang Li- |
|
Molecular characterization and phenotypical study of ?-thalassemia in Tucumán, Argentina.
Hemoglobin 2014 38 (6): 394-401. Lazarte Sandra S, Mónaco María E, Haro Ana C, Jiménez Cecilia L, Ledesma Achem Myriam E, Issé Blanca |
|
Molecular update of ?-thalassemia mutations in the Syrian population: identification of rare ?-thalassemia mutations.
Hemoglobin 2014 38 (4): 272-6. Jarjour Rami A, Murad Hossam, Moasses Faten, Al-Achkar Wal |
|
The prevalence and molecular spectrum of ?- and ?-globin gene mutations in 14,332 families of Guangdong Province, China.
PloS one 2014 9 (2): e89855. Yin Aihua, Li Bing, Luo Mingyong, Xu Longchang, Wu Li, Zhang Liang, Ma Yuanzhu, Chen Tingting, Gao Shuang, Liang Juqing, Guo Hao, Qin Danqing, Wang Jicheng, Yuan Tenglong, Wang Yixia, Huang Wei-wei, He Wen-Fei, Zhang Yanxia, Liu Chang, Xia Sujian, Chen Qingshan, Zhao Qingguo, Zhang Xiaozhua |
|
Next generation sequencing of SNPs for non-invasive prenatal diagnosis: challenges and feasibility as illustrated by an application to ?-thalassaemia.
European journal of human genetics : EJHG 2013 Dec 21 (12): 1403-10. Papasavva Thessalia, van Ijcken Wilfred F J, Kockx Christel E M, van den Hout Mirjam C G N, Kountouris Petros, Kythreotis Loukas, Kalogirou Eleni, Grosveld Frank G, Kleanthous Mari |
|
Prevalence and genetic analysis of ?-thalassemia and ?-thalassemia in Chongqing area of China.
Gene 2013 Dec 532 (1): 120-4. Yao Xiu-Yun, Yu Jie, Chen Shi-Ping, Xiao Jian-Wen, Zheng Qi-Chen, Liu Hai-Yan, Zhang Lei, Xian Ying, Zou L |
|
Spectrum of ?-thalassemia mutations in Guizhou Province, PR China, including first observation of codon 121 (GAA>TAA) in Chinese population.
Clinical biochemistry 2013 Dec 46 (18): 1865-8. Huang Sheng-Wen, Liu Xing-Mei, Li Gui-Fang, Su Li, Wu Xian, Wang Ru-L |
|
Association between clinical expression and molecular heterogeneity in ?-thalassemia Tunisian patients.
Molecular biology reports 2013 Nov 40 (11): 6205-12. Jouini L, Sahli C A, Laaouini N, Ouali F, Ben Youssef I, Dakhlaoui B, Othmeni R, Ouennich F, Hadj Fredj S, Siala H, Becher M, Toumi N E, Fattoum S, Hafsia R, Bibi A, Messaoud |
|
Rapid prenatal diagnosis of common beta-thalassemia mutations in Southeast Asia using pyrosequencing.
Prenatal diagnosis 2013 Nov 33 (11): 1017-22. Ho Sherry Sze Yee, Huan Pei Tee, Leow Gek Har, Ching Leng Kee, Chiu Lily, Law Hai Yang, Koay Evelyn S |
|
The effect of HFE polymorphisms on cardiac iron overload in patients with beta-thalassemia major.
Pediatric hematology and oncology 2013 Nov 30 (8): 755-60. Turedi Aysen, Oymak Yesim, Me?e Timur, Yaman Yöntem, Bayraktaroglu Selen, Alpman Asude, Ozkinay Ferda, Ayd?nok Ye?im, Vergin Can |
|
Problems in determining thalassemia carrier status in a program for prevention and control of severe thalassemia syndromes: a lesson from Thailand.
Clinical chemistry and laboratory medicine : CCLM / FESCC 2013 Aug 51 (8): 1605-14. Viprakasit Vip, Limwongse Chanin, Sukpanichnant Sathein, Ruangvutilert Pornpimol, Kanjanakorn Chompunut, Glomglao Waraporn, Sirikong Monchan, Utto Witayakarn, Tanphaichitr Voravarn |
|
The influence of the BCL11A polymorphism on the phenotype of patients with beta thalassemia could be affected by the beta globin locus control region and/or the Xmn1-HBG2 genotypic background.
Blood cells, molecules & diseases 2013 Aug 51 (2): 80-4. Neishabury Maryam, Zamani Fahimeh, Keyhani Elahe, Azarkeivan Azita, Abedini Seyedeh Sedigheh, Eslami Masumeh Sadat, Kakroodi Setareh Talebi, Vesiehsari Mahjoobeh Jafari, Najmabadi Hosse |
|
[Prevalence and molecular analysis of ?-thalassemia in children of Han ethnicity in Chongqing city].
Zhonghua er ke za zhi. Chinese journal of pediatrics 2013 Jul 51 (7): 7. Yao XY, Zhang YM, Qin ZZ, Fan R, Zou L, Chen SP, Zhang L, Xie Q, Zhong XY, Xian Y, Yu J |
|
A Minimal Set of SNPs for the Noninvasive Prenatal Diagnosis of ?-Thalassaemia.
Annals of human genetics 2013 Jan . Papasavva TE, Lederer CW, Traeger-Synodinos J, Mavrou A, Kanavakis E, Ioannou C, Makariou C, Kleanthous M |
|
High throughput molecular confirmation of ?-thalassemia mutations using novel TaqMan probes.
Sensors (Basel, Switzerland) 2013 13 (2): 2506-14. Kho Siew Leng, Chua Kek Heng, George Elizabeth, Tan Jin Ai Mary An |
|
Molecular spectrum of ?-thalassemia in Fujian Province, Southeastern China.
Hemoglobin 2013 37 (4): 343-50. Huang Hailong, Xu Liangpu, Lin Na, He Deqin, Li Yin, Guo Danhua, Wang Linshuo, Wang Yan, Zhen Lin, Xu Jinbang, Lin Yu |
|
Prevalence and molecular characterization of ?-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil.
Hemoglobin 2013 37 (3): 285-90. Fonseca Silvana F, Moura Neto Jose P, Goncalves Marilda |
|
Specific and straightforward molecular investigation of ?-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.
Genetics and molecular research : GMR 2013 12 (3): 2409-15. Kho S L, Chua K H, George E, Tan J A M |
|
The spectrum of ?-thalassemia mutations in Baghdad, Central Iraq.
Hemoglobin 2013 37 (5): 444-53. Al-Allawi Nasir A S, Al-Mousawi Bassam M S, Badi Ameer I A, Jalal Sana |
|
The spectrum of ?-thalassemia mutations in Kermanshah Province in West Iran and its association with hematological parameters.
Hemoglobin 2013 37 (6): 544-52. Mehrabi Masomeh, Alibakhshi Reza, Fathollahi Soheila, Farshchi Mohammad Re |
|
Prevalence of ?-Thalassemia and hemoglobin E in two migrant populations of Manipur, North East India.
Genetic testing and molecular biomarkers 2012 Oct 16 (10): 1195-200. Achoubi Nongthombam, Asghar Mohammad, Saraswathy Kallur Nava, Murry Benrithu |
|
Genetic modifiers of ?-thalassemia and clinical severity as assessed by age at first transfusion.
Haematologica 2012 Jul 97 (7): 989-93. Danjou Fabrice, Anni Franco, Perseu Lucia, Satta Stefania, Dessì Carlo, Lai Maria Eliana, Fortina Paolo, Devoto Marcella, Galanello Ren |
|
The alpha-globin genotype does not influence sickle cell disease severity in a retrospective cross-validation study of the pediatric severity score.
European journal of haematology 2012 Jan 88 (1): 61-7. Joly Philippe, Pondarré Corinne, Bardel Claire, Francina Alain, Martin Cyr |
|
Influences of genetic variation on fetal hemoglobin.
Pediatric hematology and oncology 2011 Nov 28 (8): 708-17. He Yunyan, Lin Weixiong, Luo Jianmi |
|
Variants in genetic modifiers of ?-thalassemia can help to predict the major or intermedia type of the disease.
Haematologica 2011 Nov 96 (11): 1712-4. Badens Catherine, Joly Philippe, Agouti Imane, Thuret Isabelle, Gonnet Katia, Fattoum Synda, Francina Alain, Simeoni Marie-Claude, Loundou Anderson, Pissard Ser |
|
A melting curve analysis--based PCR assay for one-step genotyping of ?-thalassemia mutations a multicenter validation.
The Journal of molecular diagnostics : JMD 2011 Jul 13 (4): 427-35. Xiong Fu, Huang Qiuying, Chen Xiaoyun, Zhou Yuqiu, Zhang Xinhua, Cai Ren, Chen Yajun, Xie Jiansheng, Feng Shanwei, Wei Xiaofeng, Xiao Qizhi, Zhang Tianlang, Luo Shiqiang, Yang Xuehuang, Hao Ying, Qu Yanxia, Li Qingge, Xu Xiangm |
|
Plasma lipids and lipoproteins in children and young adults with major ?-thalassemia from western Iran: influence of genotype.
Molecular biology reports 2011 Apr 38 (4): 2573-8. Madani Hamid, Rahimi Zohreh, Manavi-Shad Mohammad, Mozafari Hadi, Akramipour Reza, Vaisi-Raygani Asad, Rezaei Mansour, Malek-Khosravi Shohreh, Shakiba Ebrahim, Parsian Abb |
|
The association between intragenic SNP haplotypes and mutations of the beta globin gene in a Turkish population.
Blood cells, molecules & diseases 2011 Mar 46 (3): 226-9. Bilgen Turker, Arikan Yunus, Canatan Duran, Ye?ilipek Akif, Keser Ibrah |
|
Elevated hemoglobin A2 as a marker for ?-thalassemia trait in pregnant women.
The Tohoku journal of experimental medicine 2011 223 (3): 223-6. Ou Zhanhui, Li Qing, Liu Weiqiang, Sun Xiaofa |
|
Molecular analysis of ?-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
Hemoglobin 2011 35 (4): 358-66. Fernandes Andrea Cristina, Shimmoto Marily Maria Azevedo, Furuzawa Gilberto Koiti, Vicari Perla, Figueiredo Maria Stel |
|
[Genetic analysis of ? -thalassemia mutations in the minority populations of Guizhou province].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2010 Dec 27 (6): 700-3. Yu Fang, Zhong Chunli, Zhou Qiang, Yang Yuan, Li Wei, Liu Bing, Pan Shaojin, Tang Kaiyuan, Fang Rong, Jin Weij |
|
Rapid identification of common ?-thalassemia mutations in the Chinese population using duplex or triplex amplicon genotyping by high-resolution melting analysis.
Genetic testing and molecular biomarkers 2010 Dec 14 (6): 851-6. He Xiang, Sheng Min, Xu Miao, Xiong Can, Ren Zhaor |
|
Relative protection from ischaemic heart disease in beta-thalassaemia carriers.
Journal of the College of Physicians and Surgeons--Pakistan : JCPSP 2010 Oct 20 (10): 653-6. Bozdar Manzar, Ahmed Suhaib, Anwar Jale |
|
Age, beta thalassaemia trait, and iron-deficient anaemia significantly affect reticulocyte indices in pre-school children.
European journal of pediatrics 2010 Sep 169 (9): 1097-104. Chouliaras Giorgos L, Stamoulakatou Alexandra, Tsiftis George, Perissaki Georgia, Premetis Evangelos, Lycopoulou Lil |
|
Alpha-thalassemia is associated with a decreased occurrence and a delayed age-at-onset of albuminuria in sickle cell anemia patients.
Blood cells, molecules & diseases 2010 Aug 45 (2): 154-8. Nebor Danitza, Broquere Cédric, Brudey Karine, Mougenel Danielle, Tarer Vanessa, Connes Philippe, Elion Jacques, Romana Ma |
|
Epidemiology of beta-thalassaemia in Western India: mapping the frequencies and mutations in sub-regions of Maharashtra and Gujarat.
British journal of haematology 2010 Jun 149 (5): 739-47. Colah Roshan, Gorakshakar Ajit, Phanasgaonkar Supriya, D'Souza Edna, Nadkarni Anita, Surve Reema, Sawant Pratibha, Master Dilip, Patel Ramesh, Ghosh Kanjaksha, Mohanty Dipi |
|
Reverse hybridization StripAssay detection of beta-thalassemia mutations in northeast Egypt.
Hematology (Amsterdam, Netherlands) 2010 Jun 15 (3): 182-6. Soliman Othman E, Yahia Sohier, Shouma Amany, Shafiek Hala K, Fouda Ashraf E, Azzam Hanan, Abousamra Nashwa K, Mahfouz Rabab, Goda Enas F, El-Sharawy Solafa |
|
Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study.
BMC medical genetics 2010 11 . Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA |
|
Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques.
Molecular biology reports 2010 Jan 37 (1): 149-54. Rahimi Zohreh, Muniz Adriana, Parsian Abb |
|
The Xmn1 polymorphic site 5' to the (G)gamma gene and its correlation to the (G)gamma:(A)gamma ratio, age at first blood transfusion and clinical features in beta-thalassemia patients from Western Iran.
Molecular biology reports 2010 Jan 37 (1): 159-64. Nemati Hooshang, Rahimi Zohreh, Bahrami Gholamre |
|
The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity.
BMC medical genetics 2010 11 (1): 31. Chen Wanqun, Zhang Xinhua, Shang Xuan, Cai Ren, Li Liyan, Zhou Tianhong, Sun Manna, Xiong Fu, Xu Xiangm |
|
Hydroxyurea-induced hematological response in transfusion-independent beta-thalassemia intermedia: case series and review of literature.
Pediatric hematology and oncology 2009 Nov 26 (8): 560-5. Ehsani Mohammad Ali, Hedayati-Asl Amir Abbas, Bagheri Alireza, Zeinali Syrus, Rashidi Arm |
|
[Study on the incidence of beta-Thalassemia and genotypes among children under 7 year-olds in Nanning, Liuzhou and Baise areas, Guangxi province].
Zhonghua liu xing bing xue za zhi = Zhonghua liuxingbingxue zazhi 2009 Oct 30 (10): 1021-4. Qiu Xiao-qiang, Chen Ping, Zhang Ning, Zeng Xiao-yun, Huang Cai-qian, Chen Wen-qiang, Lin Wei-xiong, Li Shu-qu |
|
Alpha globin gene numbers: an important modifier of HbE/beta thalassemia.
Hematology (Amsterdam, Netherlands) 2009 Oct 14 (5): 297-300. Sharma Vineeta, Kumar Bijender, Kumar Guresh, Saxena Re |
|
Identification of beta-globin gene mutations in Thailand using an automated fluorescence-based DNA sequencer.
International journal of laboratory hematology 2009 Oct 31 (5): 521-7. Sangkitporn S K, Eksiri L, Sangnoi A, Duangruang S, Dumbua A, Rattanakittisophon K, Sangkitporn |
|
Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.
The Journal of molecular diagnostics : JMD 2009 Jul 11 (4): 334-46. Thongnoppakhun Wanna, Jiemsup Surasak, Yongkiettrakul Suganya, Kanjanakorn Chompunut, Limwongse Chanin, Wilairat Prapon, Vanasant Anusorn, Rungroj Nanyawan, Yenchitsomanus Pa-Th |
|
The relationship between the type of mutation in the globin gene and the type and severity of sickle/beta-thalassemia disease in Jordanian patients.
Saudi medical journal 2009 Jul 30 (7): 967-8. El-Akawi Zeyad J, Al-Remawi Hala S, Al-Namarneh Khadijeh |
|
Hypocholesterolemia in adult patients with thalassemia: a link with the severity of genotype in thalassemia intermedia patients.
European journal of haematology 2009 Mar 82 (3): 219-22. Ricchi Paolo, Ammirabile Massimiliano, Spasiano Anna, Costantini Silvia, Di Matola Tiziana, Cinque Patrizia, Pagano Leonilde, Prossomariti Lucia |
|
Microcytic hypochromic anemia patients with thalassemia: genotyping approach.
Indian journal of medical sciences 2009 Mar 63 (3): 101-8. Rahim Fakh |
|
Perinatal zidovudine prophylaxis in HIV type-1-infected pregnant women with thalassaemia carriage in Thailand.
Antiviral therapy 2009 14 (1): 1. Briand N, Pornprasert S, Ngo-Giang-Huong N, Galactéros F, Pissard S, Tatu T, Sanguansermsri T, Jourdain G, Lallemant M, Le Coeur S |
|
[Survey on thalassemia among people of reproductive age in Guilin City, Guangxi, China].
Zhonghua liu xing bing xue za zhi = Zhonghua liuxingbingxue zazhi 2009 Feb 30 (2): 156-8. Deng Jun-yao, Long An-yi, Li H |
|
A pilot beta-thalassaemia screening program in the Albanian population for a health planning program.
Acta haematologica 2009 121 (4): 234-8. Baghernajad-Salehi Leila, D'Apice Maria Rosaria, Babameto-Laku Anila, Biancolella Michela, Mitre Anila, Russo Silvia, Di Daniele Nicola, Sangiuolo Federica, Mokini Vahe, Novelli Giusep |
|
beta-Thalassemia mutations in the Iranian Kurdish population of Kurdistan and West Azerbaijan provinces.
Hemoglobin 2009 33 (2): 109-14. Haghi Mehdi, Khorshidi Shohre, Hosseinpour Feizi Mohammad Ali, Pouladi Nasser, Hosseinpour Feizi Abbas |
|
Detection of beta-globin gene mutations among Kelantan Malay thalassaemia patients by polymerase chain reaction restriction fragment length polymorphism.
Singapore medical journal 2008 Dec 49 (12): 1046-9. Rozitah R, Nizam M Z, Nur Shafawati A R, Nor Atifah M A, Dewi M, Kannan T P, Ariffin N, Norsarwany M, Setianingsih I, Harahap A, Zilfalil B |
|
G6PD deficiency, absence of alpha-thalassemia, and hemolytic rate at baseline are significant independent risk factors for abnormally high cerebral velocities in patients with sickle cell anemia.
Blood 2008 Nov 112 (10): 4314-7. Bernaudin Françoise, Verlhac Suzanne, Chevret Sylvie, Torres Martine, Coic Lena, Arnaud Cécile, Kamdem Annie, Hau Isabelle, Grazia Neonato Maria, Delacourt Christop |
|
Hemoglobin E detection using PCR with confronting two-pair primers.
Journal of the Medical Association of Thailand = Chotmaihet thangphaet 2008 Nov 91 (11): 1677-80. Intorasoot Sorasak, Thongpung Rachanu, Tragoolpua Khajornsak, Chottayaporn Mongk |
|
Significance of borderline hemoglobin A2 values in an Italian population with a high prevalence of beta-thalassemia.
Haematologica 2008 Sep 93 (9): 1380-4. Giambona Antonino, Passarello Cristina, Vinciguerra Margherita, Li Muli Rita, Teresi Pietro, Anzà Maurizio, Ruggeri Gaetano, Renda Disma, Maggio Aurel |
|
Beta-thalassemia mutations in western India.
Indian journal of pediatrics 2008 Jun 75 (6): 567-70. Sheth J J, Sheth F J, Pandya Pooja, Priya Rashi, Davla Sejal, Thakur Chitra, Flavin V |
|
Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.
Clinical biochemistry 2008 Jun 41 (9): 681-7. Li Qiang, Li Li-Yan, Huang Sheng-Wen, Li Liang, Chen Xiao-Wei, Zhou Wan-Jun, Xu Xiang-M |
|
Identification of beta thalassemia mutations in South Brazilians.
Annals of hematology 2008 May 87 (5): 381-4. Reichert Vivian C D, de Castro Simone M, Wagner Sandrine C, de Albuquerque Dulcinéia M, Hutz Mara H, Leistner-Segal Sand |
|
Reduced risk of uncomplicated malaria episodes in children with alpha+-thalassemia in northeastern Tanzania.
The American journal of tropical medicine and hygiene 2008 May 78 (5): 714-20. Enevold Anders, Lusingu John P, Mmbando Bruno, Alifrangis Michael, Lemnge Martha M, Bygbjerg Ib C, Theander Thor G, Vestergaard Lasse |
|
Analysis of beta globin mutations in the Indian population: presence of rare and novel mutations and region-wise heterogeneity.
Clinical genetics 2008 Apr 73 (4): 331-7. Edison E S, Shaji R V, Devi S G, Moses A, Viswabandhya A, Mathews V, George B, Srivastava A, Chandy |
|
Mutations and polymorphisms in hemoglobin genes and the risk of pulmonary hypertension and death in sickle cell disease.
American journal of hematology 2008 Jan 83 (1): 6-14. Taylor James G, Ackah Diana, Cobb Crystal, Orr Nick, Percy Melanie J, Sachdev Vandana, Machado Roberto, Castro Oswaldo, Kato Gregory J, Chanock Stephen J, Gladwin Mark |
|
An unusually frequent beta-thalassemia mutation in an Iranian Province.
Hemoglobin 2008 32 (4): 387-92. Eshghi Peyman, Zadeh-Vakili Azita, Rashidi Armin, Miri-Moghaddam Ebrahim, Miri-Moghadam Ebrah |
|
Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations.
BMC biotechnology 2008 8 (1): 62. Hung Chia-Cheng, Su Yi-Ning, Lin Chia-Yun, Chang Yin-Fei, Chang Chien-Hui, Cheng Wen-Fang, Chen Chi-An, Lee Chien-Nan, Lin Win- |
|
Early modification of sickle cell disease clinical course by UDP-glucuronosyltransferase 1A1 gene promoter polymorphism.
Journal of human genetics 2008 53 (6): 524-8. Martins Rute, Morais Anabela, Dias Alexandra, Soares Isabel, Rolão Cristiana, Ducla-Soares J L, Braga Lígia, Seixas Teresa, Nunes Baltazar, Olim Gabriel, Romão Luísa, Lavinha João, Faustino Pau |
|
Molecular basis of thalassemia intermedia in Iran.
Hemoglobin 2008 32 (5): 462-70. Akbari Mohammad T, Izadi Pantea, Izadyar Mina, Kyriacou Kyriacou, Kleanthous Mari |
|
Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia.
Clinical genetics 2007 Dec 72 (6): 497-505. Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer L |
|
Large-scale population genetic analysis for hemoglobinopathies reveals different mutation spectra in central Greece compared to the rest of the country.
American journal of hematology 2007 Jul 82 (7): 634-6. Samara Maria, Chiotoglou Ioanna, Kalamaras Angelos, Likousi Sophia, Chassanidis Christos, Vagena Andromahi, Vagenas Christos, Eftichiadis Eftichios, Vamvakopoulos Nikolaos, Patrinos George P, Kollia Panagou |
|
Hemoglobin variants and disease manifestations in severe falciparum malaria.
JAMA 2007 May 297 (20): 2220-6. May Jürgen, Evans Jennifer A, Timmann Christian, Ehmen Christa, Busch Wibke, Thye Thorsten, Agbenyega Tsiri, Horstmann Rolf |
|
Molecular analysis of alpha/beta-thalassemia in a southern Chinese population.
Genetic testing 2007 11 (1): 75-83. Ye Bang-Ce, Zhang Zhuanfong, Lei Zhengso |
|
Influence of Ggamma-158C --> and beta- (AT)x(T)y globin gene polymorphisms on HbF levels in Italian beta-thalassemia carriers and wild-type subjects.
Haematologica 2006 Sep 91 (9): 1275-6. Guida Valentina, Cappabianca Mara Pia, Colosimo Alessia, Rafanelli Francesca, Amato Antonio, Dallapiccola Bru |
|
Screening of concurrent alpha-thalassaemia 1 in beta-thalassaemia carriers.
The Medical journal of Malaysia 2006 Jun 61 (2): 217-20. Chong Y M, Tan J A M A, Zubaidah Z, Rahimah A, Kuldip K, George |
|
Is beta-thalassemia trait a protective factor against hypertension in young adults?
Annals of hematology 2006 Jan 85 (1): 29-31. Karimi M, Marvasti VE, Motazedian S, Sharifian M |
- Page last reviewed:Jul 30, 2019
- Page last updated:Jan 16, 2020
- Content source: